Yuji Hiwatashi, Keiko Sakakibara, Rumiko Kofuji, and
Tomoaki Nishiyama
Introduction
RACE (Rapid Amplification of cDNA Ends) is a
procedure for amplification of nucleic acid sequence from a mRNA template
between a defined internal site and unknown sequences at either the 3f and 5f
end of the mRNA.@ In general, PCR
amplification of relatively few target molecules in a complex mixture requires
two sequence-specific primers that flank the region of sequence to be
amplified.@
3'RACE
3f RACE takes advantage of the natural poly(A) tail found in mRNA as
generic priming site for PCR amplification. In this procedure, mRNAs are
converted into cDNA using reverse transcriptase (RT) and an oligo-dT adapter
primer. Specific cDNA is then directly amplified by PCR using a gene-specific
primer (GSP) that anneals to a region of known exon sequences and an adapter
primer that targets the poly(A) tail region. This permits the capture of
unknown 3f-mRNA sequences that lie between the exon and the poly(A) tail. In this
section, two protocols, one with GeneRacer kit (Invtrogen) and another with
3'RACE System for Rapid Amplification of cDNA Ends (Invitrogen), are described.
1.
GeneRacer kit (Invitrogen)
The GeneRacer kit provides a method to obtain full-length 5f and 3f
ends of cDNA using known cDNA sequence.@
The kit ensures the amplification of only full-length transcripts via
elimination of truncate messages formed during the amplification process. This
technique is based on RNA ligase-mediated and oligo-capping rapid amplification
of cDNA ends (RACE) methods, and results in the selective ligation of an RNA
oligonucleotide to the 5f ends of decapping mRNA using T4 RNA ligase.
@
Solution
required
E Physcomitrella patens
total RNA
E SuperScript III Reverse
Transcriptase
E dNTP
E 5x first strand buffer
E RNace out (RNase
inhibitor)
E GeneRacer oligo dT
primer
E TaKaRa Ex Taq Hot Start
version
E PCR buffer
E dNTP
E GeneRacer 3' primer
E GeneRacer 3' nested
primer
E Gene-specific primer
Procedure
Please refer
to the appropriate manual included with this kit.
2. 3'RACE
System for Rapid Amplification of cDNA Ends (Invitrogen)
Solution required
E Physcomitrella patens
total RNA
E SuperScript II Reverse
Transcriptase (Invitrogen)
E Adaptor Primer:
ggCACgCgTCgACTAgTACT(17) (Invitrogen)
E Anchor primer: CUACUACUACUAGGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG
E Universal Amplification
Primer (UAP) : CUACUACAUCAUggCCACgCgTCgACTAgTAC:
E GSP1
E GSP2: nested
gene-specific primer. This primer is designed to anneal 3f to GSP1 and to
contain a CAUCAUCAUCAU sequence at its 5f end.
E TaKaRa Ex Taq
E UDG (1units/µl)
E UDG cloning vector
pIMAz2 (Hiwatashi et al. 2001)
a)
Digest pGEM 3z with SmaI and than amplify with UAGUAGUAGUAGcccgggtaccgagctcgaa
and AUGAUGAUGAUGcctctagagtcgacctgcaggca using the SmaI-digested pGEM3za as
template.@ Then, purify with QIAGEN
Qiaquick PCR purification kit or equivalents.@
Use this fragment, named pIMAz2, for UDG cloning.@
E DH5alpha competent cell
E LB plate containing 50
µg/ml ampicillin
E QIA quick Gel extraction
kit or Gene Clean II kit (BIO101), etc:@
E Forward Primer:
CCCAGTCACGACGTTGTAAACG
E Reverse Primer:
AGCGGATAACAATTTCACACAGG
Procedure
1) First
strand cDNA
1)-1 Add the
following reagents to a micro tube and mix by pipetting.@
@@@ 3 µg total RNA*1
@@@ 1 µl Adaptor Primer (100mol/ul)
@@@ fill up to 11 µl
with nuclease-free water.
*1@ You can use
total RNA extracted with Isogen (Nippon gene), which is likely not so
high-purified.@ If RNA solution contains
insoluble material, use supernatant after brief centrifugation.
1)-2 Incubate
at 70˚C for 10 min, and then remove ice.@
1)-3 Add the following reagents to the microtube and mix by pipetting.
@@@ 4 µl@ 5x 1st strand Buffer
@@@ 2 µl@ 0.1 M DTT
@@@ 1 µl@ 10 mM dNTP
1)-4 Incubate
at 37˚C for 2 min
1)-5 Add 1 ul
of 200 units/µl SuperScript II Reverse Transcriptase and mix by
pipetting.
1)-6 Incubate
at 42˚C for 1 hrs to synthesize cDNA.
2) PCR
amplification
2)-1 Add the
following reagents in a PCR tube.
@@@ 2 µl@ cDNA solution
@@@ 2 µl@ Ex Taq Buffer
@@@ 2 µl@ 2.5 mM dNTP
@@@ 0.5 µl 10 pmol/µl GSP1
@@@ 0.5 µl 10 pmol/µl Anchor
@@@ 0.125 µl@ Ex Taq (5 U/ul)@
@@@ 17.5 µl@ nuclease-free water
2)-2 Set a
tube in a PCR thermal cycler.
2)-3 Perform
the following cycle.@
@@@@ 94˚C, 5 min x 1 cycle
@@@@ 94˚C, 30 sec- > 52-68˚C*6,
30 sec -> 72˚C, 2 min x 25-35 cycles*7
@@@@ 72˚C, 5 min
@@@@@@ *6 Tm (GSP1) - 5
@@@@@@ *7 Use 25-35 cycles depending on the
transcript abundance.@
2)-4 To yield
and specificity of your RACE product, perform nested PCR with GSP2 and UAP
primers.@
5) UDG
cloning using pIMAz2 and sequencing
5)-1 Separate
PCR product by electrophoresis with 1 % (w/v) agarose (SeaKem GTG, TaKaRa) and
recover a target product with QIAquick Gel Extraction kit (QIAGEN) or
equivalents.@
5)-2 Add the
following to a tube
@@@ 1-5 µl@ 10-50 ng PCR product
@@@ 2 µl@ 25 ng/µl pIMAz2
@@@ 2 µl@ 10x reaction buffer (200 mM Tris-Hcl (pH8.4), 500 mM KCl)
@@@ 1 µl 1 units/µl UDG
fill up to 20
µl with nuclease-free water.
5)-3 Incubate
at 37˚C for 30 min.@ Remove to ice.
5)-4 After
annealing, 2-4 µl of the annealing reaction should be used for
transformation.@@
5)-5 Once you
have cloned your PCR products from selected transformants, you will isolate
plasmid DNA using your method of choice. You should select 10-12 clones for
sequencing. To sequence your PCR products using pIMAz2, please refer to the
appropriate manual. You can obtain the sequence information using reverse and forward
primers.
5'RACE
5f RACE is a
technique that facilitates isolation and characterization of 5f ends from low
copy messages. In this section, a procedure based on 5f RACE system of
Invitrogen is described. First strand cDNA synthesis is primed using a
gene-specific antisense oligonucleotide (GSP1). This permits cDNA conversion from
specific mRNA or related families of mRNAs. Following cDNA synthesis, the first
strand product is purified from unincorporated dNTPs and GSP1. TdT is used to
add homopolymeric tails to the 3f ends of the cDNA. Tailed cDNA is then
amplified by PCR using a mixture of three primers. First, a nested
gene-specific primer (GSP2), which anneals 3f to GSP1 and a complementary
homopolymer-containing anchor primer are used. Then, the GSP2 primer and a
corresponding adapter primer, which anneals to the anchor primer, are used.
This allows amplification of unknown sequences between the GSP2 and the 5f end
of the mRNA.
5'RACE
System for Rapid Amplification of cDNA Ends (Invitrogen)
Solution
required
E Physcomitrella patens
total RNA
E SuperScript II Reverse
Transcriptase (Invitrogen)
E 10xReaction Buffer [200
mM Tris-HCl (pH 8.4), 500 mM KCl]
E 25 mM MgCl2
E 10 mM dNTP
E RNase H (Invitrogen)
E Glass Max DNA isolation
spin cartridge (Invitrogen)
E Terminal
deoxynucleotidyl transferase (TdT) (Invitrogen)
E 2mM dCTP
E Anchor Primer:
CUACUACUACUAggCCACgCgTCgACTAgTACgggIIgggIIgggIIg
E Universal Amplification
Primer: CUACUACAUCAUggCCACgCgTCgACTAgTAC
E GSP1: gene-specific
anti-sense primer
E GSP2: nested
gene-specific primer. This primer is designed to anneal 3f to GSP1 and to
contain a CAUCAUCAUCAU sequence at its 5f end.
E TaKaRa Ex Taq
E UDG cloning vector
pIMAz2 (Hiwatashi et al. 2001)
a)
Digest pGEM 3z with SmaI and than amplify with UAGUAGUAGUAGcccgggtaccgagctcgaa
and AUGAUGAUGAUGcctctagagtcgacctgcaggca using the SmaI-digested pGEM3za as
template.@ Then, purify with QIAGEN
Qiaquick PCR purification kit or equivalents.@
Use this fragment, named pIMAz2, for UDG cloning.@
E UDG (1 units/µl:
Invitrogen)
E High competent cell
(XL10Gold)
E LB plate supplemented
with 50 µg/ml ampicillin.
E Qiaquick Gel Extraction
kit (QIAGEN) or equivalents
E Forward Primer:
CCCAGTCACGAVGTTGTAAACG
E Reverse Primer:
AGCGGATAACAATTTCACACAGG
Procedure
1)@ First strand cDNA synthesis
1)-1 Add the following reagents to the tube, mix by
pipetting, and centrifuge briefly.
1
µl@ total RNA*1
1
µl@ GSP1 (2.5 mol/µl)
fill
up to 15 ul with nuclease-free water.
*1@ You can use total RNA extracted with Isogen
(Nippon gene), which is likely not so high-purified.@ If RNA solution contains insoluble material, use supernatant
after brief centrifugation.
1)-2 Heat at
70˚C for 10 min, then place on ice for 3 min.@
1)-3 Add the
following reagents in the tube and mix by pipetting.
@@2.5 µl@ Reaction Buffer
@@3 µl@ 25 mM MgCl2
@@2.5 µl@@ 0.1 M DTT
@@1 µl 10 mM dNTP
1)-4 Incubate
at 42˚C for 2 min.
1)-5 Add 1
µL of 200 u/ µl SuperScript II Reverse Transcriptase, and mix by
pipetting.@
1)-6 Incubate
at 42˚C for 1 hrs to synthesize first strand cDNA.@
1)-7 Incubate
at 70˚C for 15 min to denature reverse Transcriptase.
1)-8 Incubate
55˚C for 2 min.@
1)-9 Add 1
µl of RNase H and mix by pipeting.
1)-10
Incubate at 55˚C for 10 min and then place at 4˚C.@@
2)
Purification of first strand cDNA
Prior to TdT tailing, excess nucleotides and GSP1 must be
removed from the first strand product.@
For purification of the first strand cDNA, we had used GLASSMAX DNA
isolation Spin Cartridge (GIBCO).@ This
kit has, however, been not available.@
Probably, SizeSep 400 Spun Columns (Amersham Bioscience) and QiaQuick
PCR purification kit (Qiagen) can be used.@@
3)
Homopolymeric tailing of cDNA
3)-1 Add the following reagents in a tube, and mix gently.@
@@@ 10 µl cDNA
solution
@@@ 2.5 µl
10xReaction Buffer
@@@ 1.5 µl 25
mM MgCl2
@@@ 2.5 µl 2
mM dCTP
@@@ 7.5 µl nuclease-free water
3)-2 Heat at
94˚C for 3 min, then place on ice.
3)-3 Add 1
µl of TdT, and mix gently
3)-4 Incubate
at 37 ˚C for 10 min.@
3)-5 Incubate
at 65˚C for 10 min, and then at 4˚C
4) PCR
amplification
4)-1 Add the
following reagents in a PCR tube.
@@@ 2.5 µl@ Tailed cDNA solution
@@@ 2.5 µl@ 10x Ex Taq Buffer
@@@ 0.5 µl@ 10 mM dNTP
@@@ 0.125 µl@ Ex Taq (5 U/µl)@
@@@ 17.5 µl@ nuclease-free water
4)-2 Set a
tube in a PCR thermal cycler.@ Heat at
95˚C for 1 min, then at 80˚C for 1 min.
4)-3 Add 1
µl of Anchor Primer (10 pmol/µl) and 1 µl of GSP2 (10
pmol/µl) in the tube.
4)-4 Perform
the following cycle.@
@@@@ 94˚C, 5 min x 1 cycle
@@@@ 94˚C, 30 sec- > 52-68˚C
(*6), 30 sec -> 72˚C, 2 min x 25-35 cycles (*7)
@@@@ 72˚C, 5 min
@@@@@@ *6 Tm (GSP2) - 5
@@@@@@ *7 Use 25-35 cycles depending on the
transcript abundance.@ To yield and
specificity of your RACE product, perform nested PCR.@
5) UDG
cloning using pIMAz2 and sequencing
5)-1 Separate
PCR product by electrophoresis with 1 % (w/v) agarose (SeaKem GTG, TaKaRa) and
recover a target product with QIAquick Gel Extraction kit (QIAGEN) or
equivalents.@
5)-2 Add the
following to a tube
@@@ 1-5 µl@ 10-50 ng PCR product
@@@ 2 µl@ 25 ng/µl pIMAz2
@@@ 2 µl@ 10x reaction buffer (200 mM Tris-Hcl (pH8.4), 500 mM KCl)
@@@ 1 µl 1 units/µl UDG
fill up to 20
µl with nuclease-free water.
5)-3 Incubate
at 37˚C for 30 min.@ Remove to ice.
5)-4 After
annealing, 2-4 µl of the annealing reaction should be used for
transformation.@@
5)-5 You should select 10-12 clones for sequencing to ensure full
coverage of the 5f end. Many genes have alternative start sites for
transcription and splice variants. To sequence the PCR products using pIMAz2,
refer to the appropriate manual. You can obtain the sequence information using
reverse and forward primers.