Tomomichi Fujita, Tomoaki Nishiyama, Takako Tanahashi, and Mitsuyasu Hasebe

(1) whole genome sequence

The whole genome shotgun project of approximately 2,000 Mb corresponding to eight times of Physcomitrella patens subsp. patens Glansden2004 nuclear genome is on going under the Community Sequencing Program at the Joint Genome Institute of U.S. Department of Energy. All DNA sequences will be finished in 2005, and all sequence data are released to public database simultaneously with sequencing. The genome is expected to be annotated in 2006 together with data on EST, full-length cDNA sequences, 5' SAGE sequences, and BAC end sequences. All sequence data are searchable by the BLAST program in PHYSCObase (http://moss.nibb.ac.jp).

(2) EST data

EST analyses of the following five full-length cDNA libraries were performed and all ESTs are deposited in public DNA databases.

(1) Untreated protonemata library (9,944 5'ESTs; 9,352 3'ESTs)

(2) Auxin-treated library (16,733 5'ESTs; 16,763 3'ESTs)

(3) cytokinin-treated library (16,450 5'ESTs; 15,000 3'ESTs)

(4) Library for protoplasts during the first cell division (10,535 5'ESTs; 10,975 3'ESTs)

(5) Library for sporophytes before meiosis with surrounding archegonia (8,514 5'ESTs: 8,241 3'ESTs)

Together with other 18,686 mRNA sequences deposited in GenBank, total 142,182 ESTs are open in public DNA databases. These ESTs are assembled into 27,546 sequences (14,969 contigs and 12,577 singlets).

All clones corresponding to the ESTs in the five full-length cDNA libraries are distributed from RIKEN Bio Resource Center (http://www.brc.riken.jp/lab/epd/Eng/index.shtml). Available clones are searchable in PHYSCObase (http://moss.nibb.ac.jp).

(3) Full-length cDNA libraries

The following libraries will be distributed from RIKEN Bio Resource Center (http://www.brc.riken.jp/inf/en/).

(1) Untreated protonemata library:

Physcomitrella patens (Hedw.) Bruch & Schimp subsp. patens collected in Gransden Wood, Huntingdonshire, UK, was used as the wild-type strain. The protonemata were ground with the Polytron (Kinematica, Littau, Switzerland), and inoculated in BCDATG medium at 25°C under continuous light, and the tissues were harvested at the 13 and 14th days. The collected tissue contained protonemata and young gametophores with two to five leaves. Full-length cDNA was recovered by using the biotinylated CAP trapper method and the single-strand linker ligation method were used in the construction of the cDNA libraries. Clones originated from this library are designated as “pph” clones. >90% of clones that should have a complete open reading frame. Full-length cDNAs were cloned into a vector in Fig. 1, which have a pBluescriptII backbore with Amp resistance.

(2) Auxin-treated library:

Protonemata were ground with the Polytron and inoculated into BCD medium that contained 1.0 mM CaCl₂ and 1.0 mM NAA (naphthalene acetic acid; Sigma-Aldrich, St. Louis, MO) at 25°C under continuous light, and the tissues were harvested at the 8 to 11th days. The collected NAA-treated tissue contained chloronemata, caulonemata, and rhizoid-like protonemata. Full-length cDNA was recovered by using the biotinylated CAP trapper method and the single-strand linker ligation method were used in the construction of the cDNA libraries. One round of normalization was performed. Clones originated from this library are designated as “pphn” clones. >90% of clones that should have a complete open reading frame.　 Full-length cDNAs were cloned into a vector in Fig. 1, which have a pBluescriptII backbore with Amp resistance.

(3) Cytokinine-treated library:

Protonemata were ground with the Polytron and inoculated into BCD medium that contained 1.0 mM CaCl₂ and 0.50 mM BA (6-benzylaminopurine; Sigma-Aldrich) for the BA-treated specimensat 25°C under continuous light, and the tissues were harvested at the 8 to 13the days. The collected BA-treated tissue contained chloronemata, caulonemata, and malformed buds. Full-length cDNA was recovered by using the biotinylated CAP trapper method and the single-strand linker ligation method were used in the construction of the cDNA libraries. One round of normalization was performed. Clones originated from this library are designated as “pphb” clones. >90% of clones that should have a complete open reading frame. 　Full-length cDNAs were cloned into a vector in Fig. 1, which have a pBluescriptII backbore with Amp resistance.

Fig. 1 A vector used for full-length cDNA libraries.

(4) Library for protoplasts at a stage of the first cell division:

Protonemata were subcultured into BCDATG medium every ca. 5 days and protoplasts were prepared. Isolated protoplasts were incubated at 25°C under continuous light for 2-3 days, when the number of cells at a stage of the first cell division, which is asymmetric, or cells with protrusion are increased. Full-length cDNA was recovered by Vector-Capping method (Kato et al. (2005) DNA Res. 12:53-62). Clones originated from this library are designated as “pphf” clones. Full-length cDNAs were cloned into pGCAPzf3 vector (Fig. 2).

5’....GCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAA

　　　　　　　　　　　　　　　　　　　 M13 Forward Primer

　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　 T7 Transcription Start

AATTTGAATTGTAATACGACTCACTATAGGGCGAATTGGCGGCCAAATCGGCC

　　　　　　　　　　　　　　　　　T7 promoter　　　　　　　　　　　　　　　　　　　　　　　　　　　　 SfiI

GAATT(　　　　　　　　 cDNA　　　　　　　　　　　 )GGCCATAAGGGCCAGCTTGAG

　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　 SfiI

SP6 Transcription Start

TATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTC

　　　　　　　　 SP6 promoter　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　　 M13 Reverse Primer

CTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGC....3’

Fig. 2　 pGCAPzf3 Vector promoter and cloning site sequence

(5)Library for sporophytes before meiosis with surrounding archegonia:

Mosses were grown on Jiffy 7 for 4-6 weeks at 25℃ (24L) followed 3-4 weeks at 15℃ (8L16D).　 Sporophytes before meiosis together with surrounding archegonia were collected under stereomicroscope.　 Full-length cDNA was recovered by using the oligo-capping method (Maruyama and Sugano, 1994, Gene 38: 7-74). Clones originated from this library are designated as “ppsp” clones. Full-length cDNAs were cloned into pME18S-FL3 vector (AB009864) in Fig. 3.

Fig. 3　 pME18S-FL3 vector

Reference

T. Nishiyama, T. Fujita, T. Shin-I, M. Seki, H. Nishide, I. Uchiyama, A. Kamiya, P. Carninci, Y. Hayashizaki, K. Shinozaki, Y. Kohara, M. Hasebe, Comparative genomics of the Physcomitrella gametophytic transcriptome and Arabidopsis genome: implication for the land plant evolution. PNAS.100, 8007-8012 (2003)

T. Fujita, T. Nishiyama, Y. Hiwatashi, and M. Hasebe, Gene tagging, Gene- and Enhancer-trapping, and Full-length cDNA Overexpression in Physcomitrella patens.　 In New Frontiers in Bryology: Physiology, Molecular Biology, and Functional Genomics. A. J. Wood, M. J. Oliver, and D. J. Cove eds. Kluwer Academic Publishers, Dordrecht, Netherlands, pp. 111-132 (2004)