11.3 Conditional knock down for specific gene by artificial microRNA (amiRNA)


     Chaoyang Cheng, Tetsuya Kurata, and Mitsuyasu Hasebe



   miRNAs are approximately 21 nt small RNAs which derived from specific MIR gene loci. These miRNAs regulate a target gene expression through mRNA degradation. Effects of artificially constructed miRNA on knocking down a target gene have been examined in Arabidopsis and Physcomitrella (Schwab et al., 2005, 2006; Khraiwesh et al., 2008).

   In this chapter, we describe an inducible knock-down system combining the advantage of amiRNAs and the inducible expression method using XVE system (see chapter * in this manual).



Schwab et al.,

Specific effects of microRNAs on the plant transcriptome.

Dev Cell 8: 517–527 (2005)

Schwab et al.,

Highly specific gene silencing by artificial microRNAs in Arabidopsis.

Plant Cell 18: 1121–1133 (2006)

Khraiwesh et al.,

Specific Gene Silencing by Artificial MicroRNAs in Physcomitrella patens: An Alternative to Targeted Gene Knockouts

Plant Physiol. 148: 684-693 (2008)


Materials and Methods


Design for amiRNA

  amiRNA sequences for specific genes were designed using amiRNA designer web site (WMD2; http://wmd2.weigelworld.org/cgi-bin/mirnatools.pl?page=3). Criteria for selecting amiRNA’s sequence are mentioned in this web site.









Oligo primers for PCR are also designed in this web page (see OLIGO button).












Construction for amiRNA precursor

  For constructing amiRNA precursors, fragment I, II, and III were amplified using primers hybridizing miR319a (miR319a-F: CACCACAAACACACGCTCGGACG [CACC at the 5' end is for pENTR/D-TOPO] and miR319a-R: CCTATCCATGGCGATGCC) and the 4 oligo primers designed above (miR-s~miR*a). PCR enzyme KODplus (Toyobo) and miR319a precursor fragment plasmid cloned into pRS300 as a template were used (Schwab et al., 2006). The amplified fragments were agarose-gel extracted using QIAquick Gel Extraction Kit (QIAGEN) to exclude the primers and template DNA, and were fused by PCR using the miR319a-F and –R.





Cloning amiRNA precursor into estradiol inducible vector pGX6 or pGX8

  Resulted primary-amiRNA fragment was cloned into pENTR (invitrogen), and sub-coned into pGX6 (or pGX8)-Gateway destination vector (See chapter * in this manual). The resulted plasmid is digested to linearize for transformation of Physco.



RT-PCR to examine knock-down of targeted RNA by induced amiRNA

  Physco transgenic lines expressing amiRNA precursor were treated by 2uM estradiol for 2 to 9 days, for total RNA extraction and phenotype observation. Total RNA was extracted with RNAeasy (Qiagen) from the total tissues (including protonema, gametophore, and rizhoid) at 2 days-treated moss. 1ug Total RNA was used for reverse transcription using Ready-To-Go You-Prime First-Strand Beads (GE healthcare). Reaction mixtures were diluted to 5 folds before used for PCR. Primers upstream of the cleavage site were designed for PCR. We use KODplus (Toyobo) for semi-quantitative RT-PCR, and QuantiTect SYBR Green PCR Kit (QIAGEN) and the 7500 Real Time PCR system (Applied Biosystme) for quantitative RT-PCR (QRT-PCR). The delat-delta method was used to calculate the relative difference among sample in QRT-PCR.