11.2 RNA interference

Yuji Hiwatashi



RNA interference (RNAi) takes advantage of the unique ability of double-stranded RNA (dsRNA) molecules to induce posttranscriptional gene silencing in a highly specific manner. An RNAi construct is introduced to protoplasts by PEG-mediated transformation. RNAi becomes effective at the 2 to 3 cell stage after protoplast regeneration.  A loss-of-function phenotype of FtsZ1, the larger chloroplast than in wild type, is observed only in an apical cell at the three or more cell-stage of protonemal growth, 6 days after transformation. RNAi for GFP is effective 4 days after transformation, and GFP signals were diminished in all cells.


   Steps for RNAi experiments:

1) Clone a DNA fragment of a target gene into the entry vector pENTR/D-TOPO

2) Transfer the DNA fragment in pENTR/D-TOPO to a destination vector pPI1 using the GATEWAY system.

3) Co-transform protoplasts with both the pPI1 derived-RNAi plasmid and a plasmid harboring a visual expression marker.

4) Observe regenerated protoplasts expressing the visual marker gene.



pENTR Directional TOPO Cloning Kit (Invitrogen)

Wizard Mini-Prep kit (Promega)

Hi Speed Midi kit (QIAGEN)

Reagents for PCR amplification

Reagents for agarose gel electrophoresis

Gateway LR Clonase Enzyme Mix (Invitrogen)

QIAquick gel extraction kit (QIAGEN)

Reagents for PEG-mediated transformation

pPI plasmid (see fig. 1).  This gateway plasmid for RNAi was originally designed and constructed by Dr. Tsuyoshi Nakagawa (Shimane Univ., Japan) and modified by Y. Hiwatashi.



1. Cloning of a gene of interest into the entry vector pENTR/D-TOPO.

Refer to the pENTR Directional TOPO Cloning Kit manual (cat.no.K2400-20).







1) Design your PCR primer with CACC at the 5’ end (modification of the 3’ primer is not necessary).  Amplify your gene with a proofreading enzyme (see below). 

PCR   total 20 µl

1 ul   template cDNA

2 ul   10x KOD+ buffer

2 ul   2.5 mM dNTPs

0.8 ul  25 mM MgSO4

0.6 ul  10 pmol/ul primer1

0.6 ul  10 pmol/ul primer2

0.4 ul  1 u/ul KOD+

12.6 ul  H2O


PCR cycle

94C,   2 min

94˚C,   15 s     ━━┓

Tm-5˚C, 30 s        x 30

68˚C,   1 m/1kb  ━━┛



2) Mix your PCR product with the pENTR vector, transform E.coli, and plate.

TOPO reaction   total  1.5 µl

0.25 ul  Salt

0.5 ul   H2O

0.25 ul  pENTR/D-TOPO

0.5 ul   PCR product (5-20 mg)


Incubate at room temperature for more than 5 min. 

Transform  competent cells XL10-GOLD with all the solution, then spread all the cells on an LB plate supplemented with 50 mg/l kanamycin, and incubate at 37˚C overnight.


3) Select positive clones by colony PCR. 

4) Mini-prep a positive plasmid with a Wizard Mini prep Kit or equivalent.

5) Digest the plasmid with the appropriate restriction enzymes. 

Restriction enzyme treatment total 10 µl

3 ul   Plasmid

1 ul   10 x H

1 ul   0.1% BSA

0.5 ul  10 u/µl EcoRV

0.5 ul  10 u/µl NotI

4 ul    H2O


Incubate at 37˚C for 1 hrs. 


Perform gel-electrophoresis.


6) Confirm the direction and sequence of the fragment by sequencing

2. Transfer the DNA fragment cloned in pENTR/D-TOPO into the RNAi vector pPI1 (Figure 1).

Refer to the Gateway LR Clonase Enzyme Mix manual (cat.no.11791-019).


1) Digest the pPI1 vector with a restriction enzyme togenerate a linear form.

1.5 ul   1 µg/µl pPI1

1 ul    10 x H

0.5 ul  10 u/µl Xho I

8 ul    H2O


Incubate at 37˚C for more than 1 hrs. 


Perform gel-electrophoresis. 


Recover the digested plasmid with QIAquick Gel extraction kit.


2) Perform the LR reaction. 

1 ul   Entry clone (supercoiled, ~60 ng)

1 ul    ~ 60 ng/µl linearized pPI1

0.8 ul  5x LR Clonase Rxn. Buffer

0.4 ul  TE


Add 0.8 µl of LR clonase enzyme mix, and then mix by pipetting


Incubate at 25˚C for more than 2 hrs. 


Add 0.4 µl of proteinase K, and then mix by pipetting.  Incubate at 37˚C for 10 min.


3) Transform competent cells DH10B (or DH5alpha) with the product from the previous step.  Spread all the cells on an LB+Amp plate and incubate at 30˚C overnight. 

4) Select a correct RNAi vector by colony PCR.  Since the LR reaction allows the inverted direction of an intron in the RNAi vector, confirm its direction by PCR.  Confirm the integration of the fragment, followed by the direction of the intron. 

First colony PCRtotal 20µl

       colony  inoculation

2 ul      10xEx Taq

2 ul      2.5 mM dNTPs

0.5 ul    10 pmol/ul 35S mini-F (CTAATCTTCGCAAGACCCTTCCTC)

0.5 ul    10 pmol/ul antisense primer

0.125 ul  5 u/ul Ex Taq

14.875 ul  H2O

PCR cycle

94˚C, 30 s    ━━┓

58˚C, 30 s      x 30

72˚C, 1 m/1 kb ━━┛




Second colony PCR (total 20 µl

2 ul      10xEx Taq

2 ul      2.5 mM dNTPs

0.5 ul    10 pmol/ul 35S mini-F

0.5 ul    10 pmol/ul GFP1r1KpnI or GFPf1SpeI

0.125 ul  5 u/ul Ex Tag

14.875 ul  H2O





PCR cycle

94˚C, 30 s    ━━┓

58˚C, 30 s      x 25

72˚C, 1 m    ━━┛



The amount of PCR amplified fragment with obtained using the 35S mini-F and GPA1r1KpnI primers should be greater than that with 35S mini-F and GPAf1SpeI primers on agarose gel electrophoresis in candidate clones.


5) Mini-prep a positive clone with a Wizard Mini Prep Kit (Promega) or equivalent.

6) Digest the plasmid with the appropriate restriction enzymes.

2 ul   plasmid

1 ul    10 x M            10x M

0.5 ul  10 u/µl Xho I        10 u/µl XhoI

0.5 ul  10 u/µl Sac I       10 u/µl KpnI

6 ul    H2O


Incubate at 37˚C for more than 1 hrs. 


Perform gel-electrophoresis.

7) Sequence the plasmid with the 35S mini-F and reverse primers. 

8) Prepare the plasmid on a large-scale with the QIAGEN hi Speed Midi Kit (QIAGEN).



3. Introduction of RNAi vector to a protoplast.

Protoplasts are co-transformed with the constructed RNAi plasmid and a visual selection marker plasmid, since the pPI1 vector itself has no marker cassette. For a visual marker plasmid, pTKM-GFP, pTKM-RFP, and pTKM-DsRED2 are used. 

1) Prepare a marker plasmid. 

2) Co-transform protoplasts with a mixture of 10 µg of the RNAi plasmid and 10 µg of a marker plasmid. As a control, co-transform with the original pPI1 plasmid instead of the RNAi plasmid.

3) Incubate the transformed protoplasts. 


4. Observation

Regenerated protonemata expressing a marker gene such as GFP and mRFP are observed.

Figure 1. pPI1


Figure 2.  pTKM-GFP